Linxira Bio SDK

A local-first, ready-to-use bioinformatics analysis platform. 50+ capabilities covering sequences, structures, expression, variants, and comparative genomics.

GitHub User Guide

Quick Start

Import Data

Drag or select FASTA, FASTQ, GFF, VCF, BED, CSV, PDB files

Inspect

Auto-detect format and show summary statistics

Analyze

Choose from 50+ capabilities, auto-matched to your data format

Results

Tables, SVG plots, interactive structure viewer, export to CSV/TSV/JSON/XLSX

Simulated Pipeline Flow

📥

Import

✅

🧹

Trim

📐

Align

🧬

Variant

🎓

Enrich

📄

Report

Simulated Run Log · linxira-bio pipeline

📄 Simulated Report Output · report/

Reports auto-generated after the pipeline (exportable in desktop app):

📊

report.html

Interactive chart report

2.4 MB · 2026-08-14 10:04

👁 preview

📄

report.pdf

Publication layout

1.8 MB · 2026-08-14 10:04

👁 preview

📋

report.json

Machine-readable results

312 KB · 2026-08-14 10:04

👁 preview

🖼

figures/

8 SVG figures

6.1 MB · 2026-08-14 10:04

👁 preview

Platform Stats

50+

Capabilities

108

Bilingual Docs

Platforms

Windows · Debian · Arch

Languages

Rust · Python · R · Java

AGPL

License

v3.0-or-later

Example Data & Results

Sequence Stats (sequence.stats.v1)

{
  "sequence_count": 3,
  "total_bases": 12,
  "min_length": 2,
  "max_length": 6,
  "mean_length": 4.0,
  "n50": 6,
  "gc_percent": 60.0
}

Expression PCA (expression.pca.v1)

{
  "pca": {
    "variance_explained": [42.3, 18.7, 9.1],
    "samples": [
      {"id": "WT_1", "PC1": -2.34, "PC2": 1.02},
      {"id": "KO_1", "PC1": 2.15, "PC2": -0.87}
    ]
  }
}

GO Enrichment (enrichment.go.v1)

{
  "analysis_type": "go",
  "query_input_count": 4,
  "query_mapped_count": 3,
  "tested_term_count": 1,
  "terms": [{
    "term_id": "GO:0000001",
    "term_name": "Process A",
    "fold_enrichment": 1.33,
    "p_value": 0.5
  }]
}

Protein Properties (protein.properties.v1)

{
  "sequence_count": 2,
  "records": [{
    "id": "standard",
    "length": 20,
    "molecular_weight_da": 2395.74,
    "isoelectric_point": 7.15,
    "gravy": -0.49,
    "aromaticity_percent": 15.0
  }]
}

Set Intersection (set.venn.v1)

{
  "set_count": 3,
  "union_size": 6,
  "set_sizes": [
    {"name": "control", "count": 3},
    {"name": "treatment", "count": 4},
  "name": "validated", "count": 4}
  ]
}

FASTQ QC (fastq.qc.v1)

{
  "read_count": 2481532,
  "total_bases": 372229800,
  "mean_read_length": 150.0,
  "gc_percent": 48.2,
  "q20_percent": 97.9,
  "q30_percent": 93.7,
  "mean_quality": 36.4
}

Variant Stats (variant.stats.v1)

{
  "variant_count": 128450,
  "snp_count": 108231,
  "indel_count": 20219,
  "transition_count": 72014,
  "transversion_count": 36217,
  "ts_tv_ratio": 1.99,
  "heterozygosity": 0.0012
}

KEGG Enrichment (enrichment.kegg.v1)

{
  "analysis_type": "kegg",
  "tested_pathway_count": 142,
  "significant_count": 23,
  "top_terms": [{
    "pathway_id": "ko04630",
    "pathway_name": "IL-17 signaling",
    "p_adjusted": 1.2e-8,
    "gene_ratio": 0.21
  }]
}

Differential Expression (expression.differential.v1)

{
  "comparison": "KO_vs_WT",
  "total_genes": 18752,
  "upregulated": 842,
  "downregulated": 691,
  "significant_padj_005": 1533,
  "lfc_shrinkage": "apeglm"
}

K-mer Count (sequence.kmer.count.v1)

{
  "k": 5,
  "distinct_kmers": 9312,
  "total_kmers": 120000,
  "top_kmers": [
    {"kmer": "AAAAA", "count": 4120},
    {"kmer": "TTTTT", "count": 3987},
    {"kmer": "GCGCG", "count": 2451}
  ]
}

Alignment QC (alignment.qc.v1)

{
  "total_reads": 4963064,
  "mapped_reads": 4821918,
  "mapped_percent": 97.2,
  "properly_paired_percent": 96.1,
  "mean_depth": 32.4,
  "duplicate_percent": 8.9
}

Sequence Length Distribution (Example)

Simulated Dataset Preview

Built-in programmatically generated datasets (FASTQ / FASTA / VCF / GFF3) let you try analyses out of the box — no real data needed. Snippets below.

FASTQ · reads.fastq.gz

@SIM:1:FC01:1:1101:1000:1000 1:N:0:ATCACG
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>CCCCCCC65
@SIM:1:FC01:1:1101:1000:1001 2:N:0:ATCACG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@SIM:1:FC01:1:1101:1000:1002 1:N:0:ATCACG
GGTGATGGCCGCTGCCGATTGCAGGCGCTGCGCTTTGCTTCGCCGCAGGGTTCTTCACTT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

FASTA · genome_sim.fa

>chr1_sim_0001 length=150 gc=48.5
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC
>chr2_sim_0002 length=150 gc=51.0
TTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAATTAA
CCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCG

VCF · variants_sim.vcf

##fileformat=VCFv4.2
##source=LinxiraBioSim
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO
chr1    11869   .       G       A       962.77  PASS    DP=154;AF=0.482
chr1    14409   .       C       T       184.30  PASS    DP=51;AF=0.235
chr1    14933   .       G       A       2102.51 PASS    DP=382;AF=0.512
chr1    16298   .       T       C       55.10   PASS    DP=14;AF=0.129

GFF3 · annotation_sim.gff3

##gff-version 3
chr1    sim     gene    11869   14409   .   +   .   ID=gene1;Name=DDX11L1
chr1    sim     mRNA    11869   14409   .   +   .   ID=tx1;Parent=gene1
chr1    sim     exon    11869   12227   .   +   .   Parent=tx1
chr1    sim     CDS     12010   12127   .   +   0   Parent=tx1
chr1    sim     exon    12595   12721   .   +   .   Parent=tx1
chr1    sim     gene    14362   29370   .   -   .   ID=gene2;Name=WASH7P

All data above is programmatically simulated for UI demonstration only.

CLI Quick Start

PowerShell / Bash

# Sequence stats
linxira-bio sequence stats sequences.fa --json

# FASTQ quality control
linxira-bio fastq qc reads.fastq --json

# Genome annotation stats
linxira-bio annotation gxf-stats annotations.gff --json

# Expression matrix PCA
linxira-bio expression pca matrix.tsv pca.json --json

# Phylogenetic tree plot
linxira-bio phylogeny tree-plot tree.nwk tree.svg --json

Capabilities

Quick Links

GitHub Repository

Source code, Issues, PRs

Linxira-OS Org

Organization homepage & all projects

User Guide Wiki

Quick Start, CLI Reference, FAQ

Capability Docs

108 bilingual capability docs

Third-Party Licenses

Full dependency license info

Official Site

Online demo & documentation

Demo Analysis Results

Typical outputs from Linxira Bio SDK capabilities. All results are structured JSON ready for downstream analysis.

comparative.dotplot.v1

phylogeny.tree.visualize.v1

expression.clustered-heatmap.v1

expression.pca.v1

variant.stats.v1

rna.secondary-structure.v1

fastq.qc.v1

enrichment.kegg.v1

expression.differential.v1

enrichment.gsea.v1

sequence.kmer.count.v1

sequence.motif.logo.v1

comparative.kaks.v1

Differential Expression Results (Example)

Gene ID	log2FC	p-value	padj	Change
BRCA1	+2.34	1.2e-8	3.5e-6	Up
TP53	+1.87	4.5e-7	6.2e-5	Up
EGFR	+1.56	2.1e-6	1.8e-4	Up
MYC	-1.23	8.7e-6	5.4e-4	Down
CDKN1A	-2.01	3.2e-9	1.1e-6	Down

1 Import

2 Inspect

3 Analyze

4 Results

Import Local Data

Supported formats: FASTA, FASTQ, GFF3/GTF, VCF, BED, CSV/TSV, PDB, mmCIF, Newick, gzip. Click a sample file to run the full simulated workflow (Import → Inspect → Analyze → Results):

Drag files here or click to browse (desktop app)

Web demo auto-uses the simulated datasets above

Dataset Summary

Auto-detected format and summary statistics

Choose Analysis Capability

Capabilities auto-matched to the imported file format (simulated subset in web demo). Click a capability to run.

Analysis Results

Results appear here after running an analysis. Tables, SVG plots, and interactive structure viewing supported.

🤖 AI Analysis Assistant (Simulated)

Built-in Agent (planned): conversational access to 50+ capabilities via three external tool channels — MCP tools, Python SDK, and CLI. Interactive simulation below.

Interactive Structure Viewer

Interactive PDB/mmCIF protein viewer (desktop: rotate, zoom, residue selection, distance measurement, image export). Simulated classic case below — hemoglobin (1HHO) oxygenation and carbon-monoxide binding.

🧊 Real 3D Structures (WebGL)

Real-time PDB rendering in browser (3Dmol.js): human hemoglobin 1HHO (α₂β₂ tetramer · 4 hemes) and bovine insulin 4INS (A/B chains · receptor-binding sites with flash animation). Drag to rotate · scroll to zoom · slow auto-spin.

Hemoglobin Tetramer

α₂β₂ · 4 × Heme (Fe²⁺) Deoxy · T state

Environment Check

Auto-detects toolchains and runtimes (Rust engine + Python/R workflows + Java plugin layer). Supports Windows, Debian, and Arch Linux.

Detection complete

x86_64

Arch

Windows 11

4/4

Core runtimes

Optional tools absent

Components & Runtimes

Component	Version	Status	Use
rustc / cargo	1.97.1	✓ OK	SDK core engine (Rust)
python	3.10.11	✓ OK	Python SDK · Biopython · NumPy
R	4.6.1	✓ OK	DESeq2 / WGCNA workflow runtime
java	21.0.10	✓ OK	TBtools-ecosystem plugin layer
samtools	—	Optional	BAM/CRAM processing (built-in fallback)
docker	—	Not found	Containerized extended workflows

Platform Support Matrix

Component	Windows 11	Debian 12	Arch Linux
Core engine (Rust)	✓	✓	✓
Python SDK	✓	✓	✓
R workflows	✓	✓	✓
Java plugin layer	✓	◐	◐
Install	msi / winget	deb / apt	pacman / AUR

Documentation & Guides

Full bilingual documentation with detailed parameters and examples for each capability

108

Capability docs (zh/en)

Analysis domains

30+

Skills

Language SDKs

Python · R · Rust

Document Categories

Project Wiki

Full user manual, tutorials, and FAQ

Capability Docs

Bilingual reference for each capability (108 capabilities)

GitHub Repo

Source code, build instructions, and contribution guide

Linxira Bio SDK

Licensed under GNU Affero General Public License v3.0 (AGPL-3.0-or-later). Project-owned components use AGPL-3.0-or-later. This does not replace or relicense third-party code.

Registered Research Sources

Source	License	Current Role
GPTomics/bioSkills	MIT	Primary method and example review source
BioTender-max/awesome-bio-agent-skills	Collection index; nested terms vary	Discovery and classification source
Linxira-OS/linxira-skills	MIT	General skill platform and policy reference

Initial Runtime Components

Component	License	Use
serde, serde_json	MIT OR Apache-2.0	Job, result, and capability serialization
csv	Unlicense OR MIT	RFC 4180-compatible CSV and configurable TSV writing
flate2	MIT OR Apache-2.0	Streaming gzip and BGZF-compatible decompression
eframe, egui	MIT OR Apache-2.0	Native desktop GUI without an embedded WebView
png	MIT OR Apache-2.0	Local structure-view snapshot encoding
rfd	MIT	Native operating-system file dialogs
rust_xlsxwriter	MIT OR Apache-2.0	Native XLSX result export
same-file	Unlicense OR MIT	Cross-platform file identity checks
sha2	MIT OR Apache-2.0	Artifact SHA-256 integrity checks
tempfile	MIT OR Apache-2.0	Temporary output for atomic table export
zip	MIT	Bounded ZIP signature and metadata inspection
jsonschema 验证栈	MIT, BSD-3, Apache-2.0, ISC, MPL-2.0, GPL-3.0-or-later	CI-only JSON Schema validation
epaint_default_fonts	OFL-1.1 AND Ubuntu-font-1.0	Default native GUI fonts
Noto Sans SC 2.002	OFL-1.1	Bundled Simplified Chinese GUI fallback
hexf-parse	CC0-1.0	Transitive shader-number parsing

Workflow Runtime Dependencies

Component	License	Status
Biopython 1.85	Biopython License Agreement	Cataloged, not redistributed yet
NumPy 2.2.4	BSD-3-Clause	Cataloged, not redistributed yet
DESeq2 ≥1.52.0	LGPL-3.0-or-later	Differential-expression workflow dependency (not redistributed)
jsonlite ≥1.8.9	MIT	R workflow dependency (not redistributed)
digest ≥0.6.37	GPL-2.0-or-later	R workflow dependency (not redistributed)
MCScanX	BSD-2-Clause	Optional external executable (not bundled)
KaKs Calculator	License of user-selected distribution	Optional external executable (not bundled)

Dependency Gate

Record SPDX identifier and source repository
Confirm compatibility with AGPL-3.0-or-later
Prefer permissive MIT, Apache-2.0, BSD, ISC, Zlib, or similarly compatible components
Review LGPL, MPL, GPL, model weights, database terms individually
Reject proprietary, source-available, field-of-use, non-commercial, or ambiguous terms
Generate machine-readable dependency report and retain required notices

View Full THIRD_PARTY.md